Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.051787 |
Chromosome: | chromosome 12 |
Location: | 3393338 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g497950 | (1 of 1) PTHR10706 - F-BOX FAMILY PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGCCCTGCTGCATGCGCTCGCCCAATCGGATGCCGCCACCGGCGTAAG |
Internal bar code: | TGTCTCTCTCCATGATTGTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4500 |
LEAP-Seq percent confirming: | 84.0909 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACCTGCTGACGAGGGTAT |
Suggested primer 2: | TGGTAGCCACTAGCCAGCTA |