Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.051791 |
Chromosome: | chromosome 13 |
Location: | 1509239 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g572700 | FAP66,FLA15,IFT144 | Intraflagellar transport protein 144; (1 of 1) PF04053//PF15911 - Coatomer WD associated region (Coatomer_WDAD) // WD domain, G-beta repeat (WD40_3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAAATGAAATGCCATCGCACAGACGAGCTCCCGGGCCCCCACCTGTAG |
Internal bar code: | GCGTCACGTGTTGAGGAGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3781 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAGGGGGTAGAAAATGGA |
Suggested primer 2: | GAGCATGGACGCATACTCGA |