| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051806 |
| Chromosome: | chromosome 1 |
| Location: | 7025214 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800128 | (1 of 4) PTHR11229:SF5 - 50S RIBOSOMAL PROTEIN L3-1, CHLOROPLASTIC | 3'UTR_intron | |
| Cre01.g800129 | (1 of 4) PTHR11229//PTHR11229:SF5 - 50S RIBOSOMAL PROTEIN L3 // 50S RIBOSOMAL PROTEIN L3-1, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAATCCCCATCCCGCAACCCAAACCCCCATCCCCCCGTTGGAGCCAGC |
| Internal bar code: | CTTCATGTTAATAACGTCGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1467 |
| LEAP-Seq percent confirming: | 86.6667 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGACAGGTGAGGGAGGAG |
| Suggested primer 2: | GCCACTACCCCACTTTCCTC |