| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.051813 |
| Chromosome: | chromosome 1 |
| Location: | 3003498 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g018900 | (1 of 1) K11971 - E3 ubiquitin-protein ligase RNF14 [EC:6.3.2.19] (RNF14, ARA54) | 5'UTR_intron | |
| Cre01.g800060 | (1 of 1) PF07297 - Dolichol phosphate-mannose biosynthesis regulatory protein (DPM2) (DPM2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGCGACAGGCGTGGCCCTTGCGCCACGGCTAGTATTTCAAGCTCTA |
| Internal bar code: | CTCGCTAGTCGGTCCGCCACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 441 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGTTTCAGCCGGACGAAT |
| Suggested primer 2: | TCCACGTGTCAACATCCAGG |