| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.051823 |
| Chromosome: | chromosome 10 |
| Location: | 6581159 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465700 | (1 of 1) PF01082//PF03712 - Copper type II ascorbate-dependent monooxygenase, N-terminal domain (Cu2_monooxygen) // Copper type II ascorbate-dependent monooxygenase, C-terminal domain (Cu2_monoox_C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAGGTGTGGGTGTGTTTGGGTGAAGTGGCGGTTGAGATGGGGTGTGG |
| Internal bar code: | GTGCCACCTGGGTACGACTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 124 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCTATCGGTCAGCGCACA |
| Suggested primer 2: | GCCCTGTCCCTACCCTTTTC |