| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.051827 |
| Chromosome: | chromosome 4 |
| Location: | 419052 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217916 | (1 of 1) IPR001395//IPR005399//IPR020471//IPR023210 - Aldo/keto reductase // Potassium channel, voltage-dependent, beta subunit, KCNAB-related // Aldo/keto reductase subgroup // NADP-dependent oxidoreductase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAGGTGCGATCCATGTGCGCTTCCTTGGTTACCATTCGCCTCCTGCT |
| Internal bar code: | TTGCTTTATCGCGAATACAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCCATCTCCTCCTGAA |
| Suggested primer 2: | CAGCCCGAGTACAACCTGTT |