| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051865 |
| Chromosome: | chromosome 16 |
| Location: | 6775930 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672350 | (1 of 1) IPR001357//IPR001841 - BRCT domain // Zinc finger, RING-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCAGGACCAGGCCAGGCACGCCAGGAGTCTGGCAACACAACACGGGG |
| Internal bar code: | TCCGTAGCATGGTGAAATGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2537 |
| LEAP-Seq percent confirming: | 86.4865 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATAGCACAGCTTGATGGC |
| Suggested primer 2: | CGTACAGTAGCTAGTGCGGG |