Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.051865 |
Chromosome: | chromosome 16 |
Location: | 6775932 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g672350 | (1 of 1) IPR001357//IPR001841 - BRCT domain // Zinc finger, RING-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTTTGACGCTCGAGGTCGTACAATGGTGAGAGGGTCACATCTCAGCTT |
Internal bar code: | AGTGTGTTATATTGAGCAGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3427 |
LEAP-Seq percent confirming: | 48.5714 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTACAGTAGCTAGTGCGGG |
Suggested primer 2: | GCATAGCACAGCTTGATGGC |