Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.051933 |
Chromosome: | chromosome 3 |
Location: | 5816933 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g187950 | SEE1 | Putative splicing endonuclease positive effector; (1 of 3) K10706 - senataxin [EC:3.6.4.-] (SETX, ALS4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGGAATGGTCGCCCAAACCAGGGGGTGGGCAGGACTGGCCGGGCGG |
Internal bar code: | AGCCTAGCGTAGAAAATGCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1687 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGATGATGTGCCAGGTGT |
Suggested primer 2: | CACTCCCACCAGGTTCTGTC |