| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.051937 |
| Chromosome: | chromosome 13 |
| Location: | 3643061 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588100 | CYN19C,ROC2,CYN5,CYN19-3 | (1 of 1) K09565 - peptidyl-prolyl isomerase F (cyclophilin D) (PPIF); Cyclophilin 19-3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACAATCCAAAACAATGGAGCGGGTGCTGTGTGTAACTTCCTTGTAAGGT |
| Internal bar code: | GGTTGGGAATCAGACCTGTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3355 |
| LEAP-Seq percent confirming: | 83.0189 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGAGTTCGGGGGAATATG |
| Suggested primer 2: | TAGGTCCCTCTACCCAACGG |