Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.051953 |
Chromosome: | plastome |
Location: | 177132 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802330 | orf2971,ftsH,ChreCp065,2716962 | ATP-dependent zinc metalloprotease; (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGTCTTGCTTGCGCTAATCGCAGTATTCCCGATACTTTGTCTGCTTGT |
Internal bar code: | CTAGCTGGGTGCAGCCGCCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2216 |
LEAP-Seq percent confirming: | 67.8571 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGTACCACTGCCACTAAA |
Suggested primer 2: | TTGACCACTAGCACCAGCAG |