| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051965 |
| Chromosome: | chromosome 5 |
| Location: | 2314016 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238260 | (1 of 1) PF13371//PF13414//PF13432 - Tetratricopeptide repeat (TPR_9) // TPR repeat (TPR_11) // Tetratricopeptide repeat (TPR_16) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTCCCTGGTCCCTGGTCCCTGGTCCCTGTCCCTGGTCCCTGTCCCTGG |
| Internal bar code: | GTTTTGGGGCCCCGTTCTCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2119 |
| LEAP-Seq percent confirming: | 68.6274 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCAGGACCAGGGACCA |
| Suggested primer 2: | CGTCAAACACACACCGACAC |