| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.051968 |
| Chromosome: | chromosome 13 |
| Location: | 4134863 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591200 | HTB38,HTB22 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTTGGCCTTCTTGGCGGCCTTGTCCGCCTTGGGCTTGGACTCCTTCT |
| Internal bar code: | CGCCCTAAAGCTCTGGTTATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2294 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGCTCTTGTGACCTTCC |
| Suggested primer 2: | GCTTTAGCCCGAGGTGAACT |