| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.052044 |
| Chromosome: | chromosome 17 |
| Location: | 3282939 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722050 | (1 of 1) K19202 - histone deacetylase complex subunit SAP30 (SAP30) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGCAACAGCAAGCGCAGAAGGGCATGCCAGGCTCCAAAACCACCTGG |
| Internal bar code: | GAGGTATCTAGTTAACCACATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1922 |
| LEAP-Seq percent confirming: | 17.0732 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACTTCGGGAAGCTGGAC |
| Suggested primer 2: | CCGTTCAAAAATGCCCGTGT |