| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.052061 |
| Chromosome: | chromosome 10 |
| Location: | 4710066 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452300 | (1 of 4) 2.1.1.62 - mRNA (2'-O-methyladenosine-N(6)-)-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGGGGCTGAAGGGCCAGGGGGGAGGCACTGCTTGCTCCGTTGGTCGC |
| Internal bar code: | GACACCAAAGCGAGCGAAAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 815 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACATAGGCACCTTCGT |
| Suggested primer 2: | ATGTTTGTGCGTGTGTGCTC |