| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052106 |
| Chromosome: | chromosome 12 |
| Location: | 4523360 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521100 | POB5 | Proteome of basal body 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTATATGCGACTGTGTTGCCATCGTCGGTCGCATGCGCAGGTGGCACA |
| Internal bar code: | ACAGTCTTATGGCTTCTTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1992 |
| LEAP-Seq percent confirming: | 89.0909 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGACATGCTTACGGTGTG |
| Suggested primer 2: | GGCAGCTACTGACCTGGTTT |