| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.052136 |
| Chromosome: | chromosome 13 |
| Location: | 2671325 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581400 | NNT1,AAA2 | Plastidic ADP/ATP translocase; (1 of 2) PTHR31187//PTHR31187:SF1 - FAMILY NOT NAMED // ADP,ATP CARRIER PROTEIN 1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGGCGGCGGCACGGGAAGGGGCAGCGGCGATGCGGGCAGGCAACGG |
| Internal bar code: | GTAGGCTCCTGAACTTACTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 122 |
| LEAP-Seq percent confirming: | 3.84615 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTCCGCTGTCAGAACAT |
| Suggested primer 2: | TCCGCAATCAACCTCAGTCC |