| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052155 |
| Chromosome: | chromosome 6 |
| Location: | 3000130 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g274150 | HFO32,HFO6,HFO31,HFO43 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGACGGCCATGGACGTGGTGTACGCCCTGAAGCGCCAGGGCCGCACCC |
| Internal bar code: | CGTGGTCTGCATAGGTGTGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3898 |
| LEAP-Seq percent confirming: | 72.0 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACACCGTACCATACCGCC |
| Suggested primer 2: | TCCTTGGGCATGATGGTCAC |