Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.052183 |
Chromosome: | chromosome 8 |
Location: | 1399543 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g364300 | FAP29 | (1 of 3) PTHR10338//PTHR10338:SF110 - VON WILLEBRAND FACTOR, TYPE A DOMAIN CONTAINING // VON WILLEBRAND FACTOR A DOMAIN-CONTAINING PROTEIN 5A; von Willebrand Factor Type A Domain Flagellar Associated Protein 29 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCTTCCAAGCACGCACGCAAATAACCACACACGCGAGTCACTCACCC |
Internal bar code: | GGGCGAGGTTTCTAATTTGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 878 |
LEAP-Seq percent confirming: | 93.3333 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTGGGTTAGAGTGTTGGG |
Suggested primer 2: | CATCAACTCCCCTCCCACAC |