| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.052258 |
| Chromosome: | chromosome 5 |
| Location: | 3598930 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234250 | MBD4 | (1 of 1) K10801 - methyl-CpG-binding domain protein 4 (MBD4); Thymine DNA glycosylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATGAACCGTTCTGCGCACGGCGGTGCCGCCTCTCGGCCACTAGGCTG |
| Internal bar code: | GACTAGGATTCACCTCCCTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2756 |
| LEAP-Seq percent confirming: | 79.7101 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTGCTTTGCAAAACGGA |
| Suggested primer 2: | GCGAGTTGAACACGTGCTTT |