Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.052277 |
Chromosome: | chromosome 10 |
Location: | 1700352 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429800 | COQ8,ABC1 | Ubiquinone biosynthesis protein; (1 of 1) PTHR10566:SF65 - UBIQUINONE BIOSYNTHESIS PROTEIN COQ-8 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGCCGCACGGCGCTGGTGTGTGTCCTGGGCGGGCACACAATCCCCAA |
Internal bar code: | CGTGCTCTGTAAGATCATAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 147 |
LEAP-Seq percent confirming: | 42.8571 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATAGAACATCTCGCGGCAGG |
Suggested primer 2: | CTCTCGTCCTCACCCAAACC |