Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.052441 |
Chromosome: | chromosome 16 |
Location: | 7972556 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g691440 | FAP43 | Flagellar Associated Protein 43; (1 of 2) PTHR14885//PTHR14885:SF1 - UNCHARACTERIZED // WD REPEAT-CONTAINING PROTEIN 96 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACATTCTTTTACAGCTTTGAGCGACCCCGCGAGGGGGGTCCGATAAGTC |
Internal bar code: | TTGGATTCTTTGTTAATTCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 964 |
LEAP-Seq percent confirming: | 45.614 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 31 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCAAAGTTGGCCGGGTTTC |
Suggested primer 2: | ACAATGACAGAGCAGTCCGG |