| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052459 |
| Chromosome: | chromosome 10 |
| Location: | 2355749 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434700 | (1 of 11) IPR017956 - AT hook, DNA-binding motif | 5'UTR | |
| Cre10.g434726 | (1 of 1) K15163 - mediator of RNA polymerase II transcription subunit 12, fungi type (SRB8, MED12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTAATGCGTACGTAGACCAGAGCGGAAGGCGGAGTGGGCTTGCAGGCG |
| Internal bar code: | TGTCGGTCTGATTTCGCAAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2308 |
| LEAP-Seq percent confirming: | 84.4156 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTAAACCGACAGAACCG |
| Suggested primer 2: | TGATAGGAATTCGAGCGCCC |