| Insertion cassette: | CIB2 | 
| Side of cassette: | 3' truncated? | 
| Strand: | + | 
| Strain: | CLIP2.052543 | 
| Chromosome: | chromosome 10 | 
| Location: | 3867183 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre10.g446200 | (1 of 1) PF11566 - PI31 proteasome regulator N-terminal (PI31_Prot_N) | intron | 
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCATACATCCGGTTACCCAATCACCCCCACCTAACAGGTGTGGTCGT | 
| Internal bar code: | TCATTAGAATTGTTAGATCGAA | 
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1247 | 
| LEAP-Seq percent confirming: | 87.5 | 
| LEAP-Seq n confirming: | 14 | 
| LEAP-Seq n nonconfirming: | 2 | 
| LEAP-Seq n unique pos: | 16 | 
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCTCATCCATCCCTCCA | 
| Suggested primer 2: | GTTGTTTGTGAGCCAGCCAG |