| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.052555 |
| Chromosome: | chromosome 12 |
| Location: | 101785 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g484100 | RPC19 | (1 of 1) K03020 - DNA-directed RNA polymerases I and III subunit RPAC2 (RPC19, POLR1D); DNA-directed RNA polymerase subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGTAGCGCCTTGGCAGGGCACCGTGCGTACCTCGACCCGTGGTGGCG |
| Internal bar code: | AGATAAAATATCGCGGCTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 114 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCACCCTTACTGTTGACT |
| Suggested primer 2: | ATGATGCGCTTCTCGTAGGG |