| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.052561 |
| Chromosome: | chromosome 16 |
| Location: | 5827682 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679900 | XRN3 | 5' to 3' exoribonuclease; (1 of 1) K12619 - 5'-3' exoribonuclease 2 (XRN2, RAT1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTAATCGCGGGACACGTAAAGCAAGGCAGTACATAAGCTATGGGACCC |
| Internal bar code: | CCGTCCCCGTACTGAGAGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 884 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCACCTCCATACCTCCA |
| Suggested primer 2: | TCCTTCCATCTCCTCCCCTG |