| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.052667 |
| Chromosome: | chromosome 11 |
| Location: | 3419996 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477200 | IFR1 | Putative 2'-hydroxyisoflavone reductase; (1 of 19) PF01370 - NAD dependent epimerase/dehydratase family (Epimerase) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGCAGGCAATCTTAGATGAGGGGGCGGGATGGGGACGGGGATGGCGC |
| Internal bar code: | GATGTTGTTAGGGTGATGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 322 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATCAGCGCATGCATCACA |
| Suggested primer 2: | GTGCTGTTTGTGAGCTGGTG |