Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.052702 |
Chromosome: | chromosome 8 |
Location: | 1230312 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g363350 | (1 of 2) IPR003034//IPR009061 - SAP domain // Putative DNA-binding domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCTGACGGCCGCCGCTGCCCCGTGCCGCTGCGGCTGTGGCTGGCGCTG |
Internal bar code: | AACTAGCCGCCCATAATCTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2762 |
LEAP-Seq percent confirming: | 45.1613 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCGCCTGAATGTGAGTA |
Suggested primer 2: | GAGGTTACAACACGGAGGGG |