| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.052794 |
| Chromosome: | chromosome 13 |
| Location: | 2785467 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g801538 | (1 of 73) IPR000477//IPR005135 - Reverse transcriptase domain // Endonuclease/exonuclease/phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCAGATGAGAGCTACTGGCACCTTGCAAGATGAGGCTGCACGGGCCG |
| Internal bar code: | GCGCAAGTTAGGCTTCAAACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3393 |
| LEAP-Seq percent confirming: | 2.53165 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCGAAACGTCACCCTTCT |
| Suggested primer 2: | CTGAAGGCGAGGACGAGATC |