| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052813 |
| Chromosome: | chromosome 6 |
| Location: | 1347092 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g259200 | EFS2,EFS1,SELB,SELB1 | Selenocysteine-specific elongation factor EF-Sec; (1 of 1) PTHR23115:SF91 - SELENOCYSTEINE-SPECIFIC ELONGATION FACTOR | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTTGCCTCACCTGCACGGGTTGTTTGAACATCTGCATGCTCTTGAC |
| Internal bar code: | GGTCGGGTCGAGGGCTTTTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 569 |
| LEAP-Seq percent confirming: | 8.62069 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACGGACATCGGTAACAA |
| Suggested primer 2: | GTGGGGAGAGGATTTGTGGG |