| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.052874 |
| Chromosome: | chromosome 13 |
| Location: | 2055053 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576760 | ELI6,ELIP6 | Early light-induced LHC-like protein; (1 of 6) PTHR14154:SF5 - EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-RELATED | intron |
| Cre13.g576800 | PHX21,HIF1,HIF | (1 of 1) K09592 - hypoxia-inducible factor prolyl hydroxylase (EGLN, HPH); Cytosolic prolyl 4-hydroxylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCCATTCAACACGCCCGTCCATGCAACACCCCAGCCAACGCGCGCCT |
| Internal bar code: | GGCCCCAGTGTGAGTGCGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1884 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCCGCGAAACTGCAGGTA |
| Suggested primer 2: | TGCTCGACCAGGTTTCAGTC |