Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.052903 |
Chromosome: | chromosome 12 |
Location: | 7356989 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g557800 | (1 of 1) K06875 - programmed cell death protein 5 (PDCD5, TFAR19) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCCCTTCCACCTACCGCTTGGCCTCCTCCTGTGCCTCAATATCCTCC |
Internal bar code: | AGTAACGTGACTATTAAGTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3157 |
LEAP-Seq percent confirming: | 93.8144 |
LEAP-Seq n confirming: | 91 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTTCAACTTCGGTGGTCG |
Suggested primer 2: | GAGTAAGGAGGGAGGGAGCA |