| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052964 |
| Chromosome: | chromosome 12 |
| Location: | 702936 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492850 | POC19 | Proteome of centriole protein 19; (1 of 1) PF10595 - Uncharacterised protein family UPF0564 (UPF0564) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTGGGATACTAAATGCTTGCTGCTCTTCATTTCCTGTATTTGATCTG |
| Internal bar code: | ATGATTTGCGCATGATAGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2219 |
| LEAP-Seq percent confirming: | 62.1622 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACAGGTTGCAAGGTCA |
| Suggested primer 2: | CGGATCCCGTGCATTTCAAC |