| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.052974 |
| Chromosome: | chromosome 7 |
| Location: | 1951905 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325754 | (1 of 3) 2.7.11.25//2.7.12.1 - Mitogen-activated protein kinase kinase kinase / MLTK // Dual-specificity kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCGCCGCAACGTGCCCGGGTGCGGCGCAACGAAGGGAGTAGCAAGG |
| Internal bar code: | GGTCGTCTTTCCTATAAGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 413 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGCGCTGTGTTCTTTGTG |
| Suggested primer 2: | CTGGATGGATTGCACCACCT |