| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.052976 |
| Chromosome: | chromosome 6 |
| Location: | 2936983 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273300 | TST1 | (1 of 2) 6.1.1.3 - Threonine--tRNA ligase / Threonyl-tRNA synthetase; Threonyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTCAGTGCCTGCGCGGTGCGCACGTGCGCGGCGGGTGCGAGCTAGGT |
| Internal bar code: | AAGTTTAACCTTAGTATCGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1214 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTCATGGGGATTGGGAA |
| Suggested primer 2: | GACAGCGGGTGGAAGAAGAA |