| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.053017 |
| Chromosome: | chromosome 17 |
| Location: | 5735055 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740800 | (1 of 5) PF06742//PF06863 - Protein of unknown function (DUF1214) (DUF1214) // Protein of unknown function (DUF1254) (DUF1254) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGATGGCAACGGTTTCAGGCTCACCTGCACGGCGGAGGCGAGGTACTG |
| Internal bar code: | TTCAACTCTAGTGCGAGATCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1493 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTCAACGTGACGAGTCT |
| Suggested primer 2: | ACATACACACACGTCACCCC |