| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.053074 |
| Chromosome: | chromosome 6 |
| Location: | 8479902 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308900 | SAM50,TOB55 | Sorting assembly machinery 50 kDa subunit; (1 of 2) K07277 - outer membrane protein insertion porin family (SAM50, TOB55, bamA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGGGCCGTGTGGGCCCTCAGGCCTTCCACCAACCCGACGCTGCCCCC |
| Internal bar code: | AGCGTTCAAGTTTAGATACAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 921 |
| LEAP-Seq percent confirming: | 2.7027 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGACAGGCTGTGACGAAA |
| Suggested primer 2: | GGGGCAGATAGAGCAGTGAC |