| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.053080 |
| Chromosome: | chromosome 3 |
| Location: | 2055719 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156050 | RRF1 | Putatuve chloroplast ribosome recycling factor; (1 of 2) K02838 - ribosome recycling factor (frr, MRRF, RRF) | intron |
| lncRNA_TCONS_00170328 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCAACGTATACCGCCCCATCCCAAACCCACACCCTGGGCCCATCGCG |
| Internal bar code: | TGTGTATGAGAATAGGGAGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATGTCGGACTCCTGGATG |
| Suggested primer 2: | CTAATGGCAGTGGTGGAGGG |