| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053102 |
| Chromosome: | chromosome 11 |
| Location: | 910747 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467654 | (1 of 1) K13117 - ATP-dependent RNA helicase DDX35 [EC:3.6.4.13] (DHX35) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCCACACCCACACACCCCACACACCCACCTGCGTACAGCGGCAGTG |
| Internal bar code: | TGCATCAAGGTTAAGATTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 395 |
| LEAP-Seq percent confirming: | 46.8085 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAACCAGGACCGTGACCG |
| Suggested primer 2: | GTGGCAGTGCGTTGAAACAT |