Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.053129 |
Chromosome: | chromosome 2 |
Location: | 239634 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g074626 | CSB11 | (1 of 1) IPR000104//IPR010095//IPR013083 - Antifreeze protein, type I // Transposase IS605, OrfB, C-terminal // Zinc finger, RING/FYVE/PHD-type; {"Probable transposon-derived protein of Chlamydomonas-Specific family B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACTCAACCCACCCACCTTGGAGGTCTTGTATTCATCGATGATGAACA |
Internal bar code: | CGGTTAGTACGATCTTGAATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1369 |
LEAP-Seq percent confirming: | 68.5714 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCACAGTTGTCAACAGCC |
Suggested primer 2: | CGTTATCAACCCAGCCACCT |