| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.053143 |
| Chromosome: | chromosome 16 |
| Location: | 7472803 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681802 | (1 of 2) PF00069//PF01590//PF07714 - Protein kinase domain (Pkinase) // GAF domain (GAF) // Protein tyrosine kinase (Pkinase_Tyr) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGATCTGCACGCGCTCCCACACCCACCTGCGTGCCCAAAATCGCCTCC |
| Internal bar code: | GAGGTCCCGCAAAGTGGAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1194 |
| LEAP-Seq percent confirming: | 42.5532 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTCAAAACGACTGCTGC |
| Suggested primer 2: | GTACAACTTCGGTCCCGTGT |