| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053196 |
| Chromosome: | chromosome 10 |
| Location: | 1010666 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424850 | SPL5,PRP31 | (1 of 1) K12844 - U4/U6 small nuclear ribonucleoprotein PRP31 (PRPF31); Pre-mRNA-splicing factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAGCCGCTAGGCGGCTAGCGAAGGCTACGGCTGGCCATCATACCAGC |
| Internal bar code: | GTCTGTTACGGGGCCATCAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1674 |
| LEAP-Seq percent confirming: | 13.3333 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCCTATGCGCCGGGATA |
| Suggested primer 2: | TCTGAAGACGAGGAGGGGAG |