Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.053196 |
Chromosome: | chromosome 10 |
Location: | 1010666 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g424850 | SPL5,PRP31 | (1 of 1) K12844 - U4/U6 small nuclear ribonucleoprotein PRP31 (PRPF31); Pre-mRNA-splicing factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAGCCGCTAGGCGGCTAGCGAAGGCTACGGCTGGCCATCATACCAGC |
Internal bar code: | GTCTGTTACGGGGCCATCAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1674 |
LEAP-Seq percent confirming: | 13.3333 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTCCTATGCGCCGGGATA |
Suggested primer 2: | TCTGAAGACGAGGAGGGGAG |