| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.053302 |
| Chromosome: | chromosome 1 |
| Location: | 5275542 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037000 | SCPL49,CPY | Serine carboxypeptidase; (1 of 2) PTHR11802//PTHR11802:SF72 - SERINE PROTEASE FAMILY S10 SERINE CARBOXYPEPTIDASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGGGCTTCTGGGTAAAGGGAAACACGGGCAGCCCTCGCCTCAGTGCC |
| Internal bar code: | TCAACGTCGTTGTTGATATGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2086 |
| LEAP-Seq percent confirming: | 6.49351 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGCATCACACACATACAG |
| Suggested primer 2: | GACATTCCTGAACGCGCTTC |