| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.053317 |
| Chromosome: | chromosome 6 |
| Location: | 5276651 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284400 | (1 of 1) K06695 - 26S proteasome regulatory subunit, ATPase 3, interacting protein (PSMC3IP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAATGTAGCCGGTATAGCTATCACGGGATACCGAGTGATGCGTTACAGG |
| Internal bar code: | CTAAAAATTGGGCAATTAAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 485 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTTCGGCTATACTCCGC |
| Suggested primer 2: | GTCCTGGCGTGGTACGATAG |