| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.053342 |
| Chromosome: | chromosome 16 |
| Location: | 7262271 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677765 | (1 of 4) PF00207 - Alpha-2-macroglobulin family (A2M) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAAACTAATTATTGGGCCCTCGAGTACCCACACGGGTACCAAAAATT |
| Internal bar code: | TGACACAACGATTGGTCGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3292 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAGTGAAGTGCCGACGT |
| Suggested primer 2: | CTCGCCCACATTTGCATAGC |