Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.053354 |
Chromosome: | chromosome 12 |
Location: | 7552317 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g556200 | (1 of 1) PF15011 - Casein Kinase 2 substrate (CK2S) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAAATCGCACGAGTGCTTGGAAAGATGGCTCGCGCTCCAGGTGATTTG |
Internal bar code: | ATACACGGGTGAAGTGACTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3394 |
LEAP-Seq percent confirming: | 98.8506 |
LEAP-Seq n confirming: | 86 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAGGAGGAAAAGGGCGAC |
Suggested primer 2: | CCCCTAGGCGTTGTATGGTC |