| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.053418 |
| Chromosome: | chromosome 10 |
| Location: | 5818364 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g460350 | PGA4 | Putative phospholipid/glycerol acyltransferase; (1 of 3) 2.3.1.25 - Plasmalogen synthase | 3'UTR_intron |
| Cre10.g460400 | (1 of 1) PF00642//PF04564 - Zinc finger C-x8-C-x5-C-x3-H type (and similar) (zf-CCCH) // U-box domain (U-box) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCAGCTCCTGCGTCCGTCGTGGACACCTCCCACTTATCCTTTCCGCCC |
| Internal bar code: | GACGGTACGTCTCACGCGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1854 |
| LEAP-Seq percent confirming: | 97.0297 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAGTCCTCGCCACCTTG |
| Suggested primer 2: | CGACACTTCGCCCGTGATAG |