| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.053493 |
| Chromosome: | chromosome 10 |
| Location: | 6245844 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463300 | (1 of 1) PTHR31515:SF0 - TRANSMEMBRANE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATCATGACTGATTATATAAGCAGAAGTGAAGTTGTAGCCAGGCACAT |
| Internal bar code: | CAAACTTCAGTCACATAATTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 986 |
| LEAP-Seq percent confirming: | 67.7419 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTGCCGACCAACCCTATT |
| Suggested primer 2: | GGGCAGGTTCAAGGTCATGA |