Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.053497 |
Chromosome: | chromosome 6 |
Location: | 1586020 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g261350 | (1 of 1) PF06108 - Protein of unknown function (DUF952) (DUF952) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCATCCGCCACCCAGACCAGTCACTCTCGCGCTCGCTTACAACACGTCG |
Internal bar code: | GGTAGGGGATCGGCATCATCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3735 |
LEAP-Seq percent confirming: | 97.4026 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACCGGTACACGTACAC |
Suggested primer 2: | GCTGTGTGGATCACTGGGAA |