| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053504 |
| Chromosome: | chromosome 12 |
| Location: | 9081912 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544400 | STK | (1 of 1) K08838 - serine/threonine-protein kinase 24/25/MST4 [EC:2.7.11.1] (STK24_25_MST4); Serine/threonine protein kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACAGCAGGTCGCGATCAAGGTTATCGACCTGGATGACGTGTAAGTGTG |
| Internal bar code: | GACGACAGGATACTTGAGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2062 |
| LEAP-Seq percent confirming: | 97.9167 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAACCGCAACACAATCCT |
| Suggested primer 2: | CTTTTGCCTTCCGCTTTGCT |